şükela:  tümü | bugün
  • canlılık faaliyetleri icin gerekli bilgileri bulunduran moleküllerdir. -ne ansiklopedik oldu bea!-
  • dna&rna nükleik asitleri nükleotid diye adlandırılan alt birimlerden meydana gelirler.bu nükleotidler alt alta seker fosfatlariyla baglanarak zincir olustururlar. bağ olarak da zayif hidrojen baglarını kullanirlar..
  • genetik bilgiyi tasiyan olusum
    bir fosfat grubu, bir deoksiriboz seker ve de bir nukleotid biraraya gelir, bu gruplar fosfatlarin arasindaki fosfodiester baglar yardimiyla birbirlerine zincir gibi eklenir ve bu zincirin bir esi de birbirine uyumlu nukleotid bazlarin birlesmesiyle digeriyle kivrilarak dnaya seklini veren double helixi olusturur
    dnaya tum yasam formlarindaki cesitliligi ortaya koyma gucunu veren ise adenine, guanine, cytosine ve thymine adli 4 nukleotidin random siralanisidir
  • bir zamanlar orta kat (bkz: kemanci)'nin ismi.. simdi ne bilmiyom zart zurt degisiyor.
  • bir de dna kodlarini kullanarak mesaj yazma olayi var dna-o-gram diye..

    gctaagaaaacaatgaaggtaatgaccatgaacaaggcaagcacg
  • dört temel aminoasitten ( adenin, timin, guanin, sitozin) olu$an, hücrenin ya$amasini saglayan biyolojik yapi.
    spiral yapidadir ve herzaman adenin ve timin; guanin ve sitozin kar$ilikli dizilir.
  • sempanzelerle insanlar arasındaki dna kod farki %2 imis...
  • (bkz: windows dna)
  • madde kainati cekirdek duzeninde evrimselligin harika bir neticesi olan biyolojik bedenlerdeki uzun sureli kayitlayici uniteler.*
  • madde kainatı çekirdek düzeninde evrimselliğin harika bir neticesi olan biyolojik bedenlerdeki uzun süreli kayıtlayıcı üniteler*.